Skip to main content

Table 2 Protein-changing variants in polyneuropathy-associated candidate genes enriched in Leonberger dogs compared to 614 controls from various breeds

From: Genomic diversity and population structure of the Leonberger dog breed

Gene OMIM/ OMIA number Variant designationa Alternative allele frequency
Genomic position Coding DNA change Protein change Leonbergers Controls
CNTNAP1 602346 chr9:20,294,320 c.3863G > C p.Arg1288Pro 0.3974 0.0366
CNTNAP1 602346 chr9:20,298,261 c.2585G > A p.Gly862Glu 0.1538 0.0067
DHTKD1 614984 chr2:24,316,951 c.1820C > T p.Ala607Val 0.0897 0.0049
DIAPH3 614567 chr22:15,880,854 c.2000G > A p.Cys667Tyr 0.1538 0.0689
DST 113810 chr12:23,771,235 c.18224C > T p.Thr6075Met 0.0769 0.0008
DST 113810 chr12:23,782,332 c.17800C > T p.Arg5934Trp 0.4359 0.0330
DST 113810 chr12:23,846,624 c.10661C > T p.Ser3554Leu 0.0769 0.0369
DYNC1H1 600112 chr8:70,064,306 c.13757C > T p.Pro4586Leu 0.1282 0.0051
GARS 600287 chr14:43,322,005 c.622G > A p.Val208Ile 0.1154 0.0025
GJA9 611923/2119–9615 chr15:3,862,761 c.344G > C p.Arg115Thr 0.5513 0.0868
JPH1 605266 chr29:22,710,800 c.1531A > G p.Ile511Val 0.1923 0.0299
LOC477508 602072 chr26:16,348,822 c.298G > A p.Val100Met 0.1795 0.0066
MME 120520 chr23:49,045,461 c.1700A > T p.Gln567Leu 0.0769 0.0157
NEFH 162230 chr26:22,729,485 c.1046G > A p.Arg349His 0.2821 0.0116
NEFH 162230 chr26:22,732,974 c.1901_1924delTGAAGGAGGAGGCCAAGTCCCCAG p.Val640_Pro647del 0.3974 0.0849
NEFH 162230 chr26:22,733,415 c.2326C > G p.Pro768Ala 0.0513 0.0059
OTOF 603681 chr17:20,534,866 c.3451G > A p.Ala1151Thr 0.7051 0.0094
PDXK 179020 chr31:37,707,445 c.774G > C p.Arg258Ser 0.1923 0.0898
PRX 605725 chr1:113,290,407 c.784G > A p.Ala262Thr 0.1282 0.0257
SBF2 607697 chr21:33,036,988 c.4114C > T p.Pro1372Ser 0.1667 0.0361
SLC12A6 604878 chr30:853,540 c.2498C > T p.Ala833Val 0.0513 0.0250
WNK1 605232 chr27:42,911,057 c.7448C > G p.Thr2483Arg 0.0128 0.0058
  1. aAdditional details including the protein prediction effects are described in Additional file 10: Table S6. All positions refer to the CanFam3.1 reference sequence assembly