Fig. 2
From: Variants at the ASIP locus contribute to coat color darkening in Nellore cattle
Phenotypic distribution conditional on haplotypes at the DHC association signal. Haplotype alleles were called on a block of 24 SNPs mapping to the association region on chromosome 13. Only two alleles had a frequency of at least 5%, namely H1 = TTGTATGTAACAATTGAAGGCCAA (frequency of 45.6%) and H2 = GCACGCGCGGTGGCCAGGAAATGG (frequency of 32.4%). The remaining 16 alleles were grouped in a single cluster (HN) for clarity. Alleles H1 and H2 exhibited contrasting phenotypic distributions, with H2 being involved with darker hair coat