Skip to main content

Table 3 Real-time PCR primer combinations

From: Differential mRNA expression of seven genes involved in cholesterol metabolism and transport in the liver of atherosclerosis-susceptible and -resistant Japanese quail strains

Primer name Gene ID Species Primer Primer sequence (5’- 3’)
GAPDH Z19086 C. coturnix Forward GGCACTGTCAAGGCTGAGAAT
Reverse GCATCTCCCCACTTGATGTTG
HMGCR NM_204485 G. gallus Forward GCAGAGGGCCTTACAAC
Reverse GGAGGAGCAAGCCGTAT
FDFT1 NM_001039294 G. gallus Forward GCCATCATGTACCAGTATGTG GAA
Reverse GCTGCGTCTTGTTGGAGGAA
SQLE NM_001030953 G. gallus Forward GAGGTAGAAATTCCTTTTCCAACATCT
Reverse GCCGTGATGGAAGGACCTT
DHCR7 XM_420914 G. gallus Forward GGGAAAGATTGGAAACGCTACA
Reverse CAGATTCTGTGTCAGCCTTAAAACA
ABCG5 XM_419457 G. gallus Forward ATTACAAGATCCCAAGGTCATGCT
Reverse GAGACGATCTGGTTTGCAGTCA
ABCG8 XM_419458 G. gallus Forward GCCTTCCAGCATGTTTTTCAG
Reverse CGCAACCGTAGCTCTGCTATT
APOA1 D85133 C. coturnix Forward TCTGGTGCAGGAATTCAAGGA
    Reverse TCATCCAGGAGGTCGATCAAG