- Research Article
- Open access
- Published:
Screening for phenotypic outliers identifies an unusually low concentration of a β-lactoglobulin B protein isoform in bovine milk caused by a synonymous SNP
Genetics Selection Evolution volume 54, Article number: 22 (2022)
Abstract
Background
Milk samples from 10,641 dairy cattle were screened by a mass spectrometry method for extreme concentrations of the A or B isoforms of the whey protein, β-lactoglobulin (BLG), to identify causative genetic variation driving changes in BLG concentration.
Results
A cohort of cows, from a single sire family, was identified that produced milk containing a low concentration of the BLG B protein isoform. A genome-wide association study (GWAS) of BLG B protein isoform concentration in milk from AB heterozygous cows, detected a group of highly significant single nucleotide polymorphisms (SNPs) within or close to the BLG gene. Among these was a synonymous G/A variation at position + 78 bp in exon 1 of the BLG gene (chr11:103256256G > A). The effect of the A allele of this SNP (which we named B’) on BLG expression was evaluated in a luciferase reporter assay in transfected CHO-K1 and MCF-7 cells. In both cell types, the presence of the B’ allele in a plasmid containing the bovine BLG gene from -922 to + 898 bp (relative to the transcription initiation site) resulted in a 60% relative reduction in mRNA expression, compared to the plasmid containing the wild-type B sequence allele. Examination of a mammary RNAseq dataset (n = 391) identified 14 heterozygous carriers of the B’ allele which were homozygous for the BLG B protein isoform (BB’). The level of expression of the BLG B’ allele was 41.9 ± 1.0% of that of the wild-type BLG B allele. Milk samples from three cows, homozygous for the A allele at chr11:103,256,256 (B’B’), were analysed (HPLC) and showed BLG concentrations of 1.04, 1.26 and 1.83 g/L relative to a mean of 4.84 g/L in milk from 16 herd contemporaries of mixed (A and B) BLG genotypes. The mechanism by which B’ downregulates milk BLG concentration remains to be determined.
Conclusions
High-throughput screening and identification of outliers, enabled the discovery of a synonymous G > A mutation in exon 1 of the B allele of the BLG gene (B’), which reduced the milk concentration of β-lactoglobulin B protein isoform, by more than 50%. Milk from cows carrying the B’ allele is expected to have improved processing characteristics, particularly for cheese-making.
Background
β-lactoglobulin (BLG) is the major whey protein in bovine milk, representing over 50% of the whey proteins and approximately 10% of the total milk protein pool [1]. BLG is a member of the lipocalin protein family, a large group of diverse proteins that have a hydrophobic, ligand-binding function [2]. BLG is found only in the milk of certain mammalian species, including artiodactyls, and is absent from human milk. The human homolog of BLG is known as the progestagen-associated endometrial protein (encoded by the PAEP gene) and has multiple roles in fertility [3]. The functional relevance of BLG in milk remains unknown although its known ligands include retinol, vitamin D, cholesterol and fatty acids [4, 5].
At least 11 protein isoforms of bovine BLG have been described [6] and categorized using an alphabetical nomenclature. The protein isoforms A and B are the most common in dairy cattle breeds and differ by two amino acids (Asp64/Val118 and Gly64/Ala118 in A and B, respectively) in the mature secreted protein. Furthermore, in a study of genomic DNA from 22 proven bulls in Holland, 50 DNA polymorphisms were identified in the coding and promoter regions of the BLG gene. More than 40 of these polymorphisms were in complete linkage disequilibrium (LD) with the SNP defining the A and B protein isoforms [7]. Bedere and Bovenhuis [8] confirmed that the A and B alleles explain most of the variation in BLG concentration in bovine milk. The lower concentration of the BLG B protein isoform in milk compared to the A protein isoform was shown to be associated with a reduced expression of the BLG B allele of ~ 60–90% compared to that of the A allele [9, 10].
Since differences in milk composition are associated with BLG genetic variants, selection for specific polymorphisms to improve milk functionality and processing characteristics can be considered. Variation in the concentration of BLG in milk is inversely associated with variation in casein number, which is calculated as a proportion of total protein content. Thus, the low-concentration BLG B protein isoform is associated with a greater casein number [10] which, in turn, is associated with enhanced cheese yield [11, 12]. In addition, milk with a lower BLG content may have advantages in terms of cheese processing since the more highly expressed BLG A allele has been implicated in increased plant-fouling during the manufacturing of ultra-high temperature (UHT) milk compared to the BLG B allele [13].
Schopen et al. [14] reported that SNPs on Bos taurus (BTA) chromosomes 6, 11 and 24 were associated with BLG concentration in milk, and Gambra et al. [15] reported that SNPs in nine genes, including genes on BTA6 and 11 (but not BTA24) were associated with BLG concentration. In Swiss Brown cattle, Braunschweig and Leeb [16] described a novel SNP that is associated with a low-concentration variant of BLG and is due to a unique C to A transversion/substitution, which is located 215 bp upstream from the translation start site of the BLG gene, although causation was not proven.
The objective of the current study was to screen a population of dairy cattle for milk with extreme (high or low) concentrations of BLG and to identify genetic variant(s) that are responsible for these observed extreme variations. This screen identified a population of cows in the New Zealand (NZ) herd that carried a sub-variant of the B allele, which results in an unusually low concentration of BLG in milk. Furthermore, we describe the genetic basis of this low BLG concentration and highlight a candidate causative mutation that underlies this effect.
Methods
The experimental steps undertaken in this study were as follows:
-
1.
Screening of milk samples from commercial dairy herds for concentrations of A and B isoforms of BLG using high-throughput, liquid chromatography/mass spectrometry.
-
2.
Identification of a population of cows producing milk with a low concentration of BLG B protein isoform and linked to the same sire family.
-
3.
Demonstration of segregation of the low BLG B protein isoform in milk from daughters of a putative sire-carrier, homozygous for the B allele of BLG.
-
4.
Identification of putative causal variants of the low BLG B isoform from a GWAS of total BLG, followed by GWAS of the concentrations of the BLG B isoform in milk from heterozygous AB BLG cows.
-
5.
Determination from in vitro gene cloning experiments that a putative causal SNP decreased the expression of a BLG/luciferase reporter construct encompassing part of the promoter sequence, exon 1, intron 1 and part of exon 2 of BLG.
-
6.
Demonstration of the association of BLG mRNA expression with the causal SNP by RNAseq.
-
7.
Evaluation of the impact of the causal SNP on milk composition.
In the following text, the variant chr11:103256256G > A in exon 1 of the B allele of BLG is referred to as B’.
Milk sampling
In total, 10,641 milk samples, from individual cows, were collected from 40 commercial dairy herds (Friesian, Jersey and their crossbreds). All milk samples were collected from October to December, corresponding to mid-lactation (approximately 70 to 130 d post-calving) for spring-calving dairy herds in New Zealand. Milk samples from all cows were collected using standard herd-testing procedures in New Zealand (LIC, Newstead, Hamilton, New Zealand). Sub-samples (1 mL) of the aqueous phase were taken from a composite am/pm milk sample, after overnight storage at 4 °C, and stored in 96-well plates at − 80 °C, until analysis. Farms were selected primarily because they were suppliers to Fonterra Co-operative Group Ltd., (Fanshawe St., Central Auckland 1010, New Zealand) and users of LIC genetics. Cow-level information, including breed, pedigree, age, calving date and milk composition was retrieved from herd records held in the LIC herd management database (MINDA®, LIC, Hamilton, New Zealand).
Screening of the milk samples for the BLG A and B protein isoforms
For the initial screening of the 10,641 milk samples, a mass spectrometry method was used to quantify the concentrations of the BLG A and B protein isoforms in milk. First, casein was removed by adding acetic acid to skim milk samples to a final concentration of 1%, followed by centrifugation for 5 min at 1000 g. The resulting whey fraction was diluted 800-fold with a 30% methanol/0.1% acetic acid/69.9% water solution, prior to analysis for BLG by mass spectrometry. Diluted whey samples were analysed by flow-injection analysis/mass spectrometry using an Agilent Technologies (Palo Alto, CA, USA) 1100 series liquid chromatograph coupled to an Agilent Technologies 6310 ion-trap mass spectrometer with an electrospray ionisation interface. Samples (30 µL) were injected into a stream of 30% methanol/0.1% acetic acid/69.9% water and were delivered to the mass spectrometer at 100 µL/min. The mass spectrometer was operated in positive ion mode and mass spectra were collected between 1400 and 1900 m/z. The level of the BLG A isoform was calculated from the signals at 1413.4, 1531.1, 1670.2 and 1837.1 m/z corresponding to [M + 13H]13+, [M + 12H]12+, [M + 11H]11+ and [M + 10H]10+, respectively, and the level of the BLG B isoform was calculated by summing the signals at 1406.8, 1523.9, 1662.4 and 1828.5 m/z corresponding to [M + 13H]13+, [M + 12H]12+, [M + 11H]11+ and [M + 10H]10+, respectively. The signals used for quantification of the BLG B protein isoform did not discriminate the B protein from the C protein isoform of BLG. However, the frequency of the C allele is low (< 1.7%) in the NZ dairy cow population (estimated from a subset of 166,000 genotyped cows imputed to sequence). Ultimately, the cows carrying the C allele were excluded based on genotyping data (see below), as a relevant source of variation.
The specific signals for the BLG A and B isoforms were characterized using BLG standards (Sigma-Aldrich, St. Louis, MO, USA) and the concentrations were expressed as arbitrary units (arb. units). For guidance, it was estimated that 80 arb. units (the average concentration found in milk from homozygous BB cows) were equivalent to 3.4 g/L of BLG, which is the mean concentration of the BLG B isoform measured in NZ milk samples from homozygous BB cows [17]. Similarly, the mean concentration of the BLG A isoform in milk samples from homozygous AA cows in NZ was 4.8 g/L, which is equivalent to an average concentration of 180 arb. units.
Validation of BLG mass spectrometry screening assay
The concentration of BLG in milk from 40 cows in mid-lactation was also determined by high-performance liquid chromatography (HPLC) as described by [18] and was found to be highly correlated with the BLG concentration determined by the LC/MS screen (see Additional file 1: Fig. S1).
Blood and tissue sampling for genotyping
Samples of ear tissue (by punch), blood or semen, depending on ease of sampling for each situation specified below, were used for DNA extraction and genotyping. When required, blood samples were collected from the coccygeal vein by venipuncture into EDTA-coated vacutainer tubes. Whole blood was stored at − 20 °C until analysis. DNA was extracted from blood and semen samples using a standard phenol–chloroform method [19] and from ear tissue samples using the Qiagen BioSprint 96 DNA extraction kit (Qiagen, Valencia, CA, USA), following the manufacturer’s instructions.
Genome-wide association studies of BLG phenotypes
Genome-wide genotypes were available for 4140 of the 10,641 screened cows with BLG phenotypes (BLG protein isoform concentrations) and 2091 of these were heterozygous (AB) at the BLG locus. Genotypes had previously been generated by Neogen (Lincoln, NE) on the Illumina Bovine SNP50 panel. The low-density SNP-chip genotypes were imputed to sequence using a dataset of 16.1 million variants identified from whole-genome sequences of a reference population consisting of 306 Holstein–Friesian, 219 Jersey and 717 crossbred cattle in the NZ dairy herd (males and females). The sequence imputation pipeline is described in [20,21,22]. BLG phenotypes (BLG protein isoform concentrations) from mass spectrometry were adjusted using a mixed linear model in the R software [23] with fixed effects included for birth year and breed, and random effects included for herd and plate number.
A GWAS was performed for total BLG concentration in the milk from 4140 cows in the BLG LC/MS screen for which genotypes were available. Furthermore, GWAS for each BLG A and B isoform concentrations (arb. units) in the milk from 1966 heterozygous AB cows were also performed by conducting a mixed linear model analysis using the GCTA v. 1.93.0 beta software package [24] across 16,122,289 imputed sequence variants. Population structure was accounted for by using a genomic relationship matrix (GRM) derived from 45,135 SNPs, constructed from 50 k-resolution genotypes, as described in [20,21,22]. A leave-one-chromosome-out (LOCO) approach was used, in which separate GRM were derived for each chromosome based on SNPs from the other chromosomes only. Significance levels were evaluated using a Bonferroni correction, with all the tests across 16,122,289 variants and three phenotypes being considered as independent traits. Based on a genome-wide threshold of α = 0.01, this resulted in a nominal p-value of 2.07e−10.
All genomic positions presented in this paper are based on the ARS-UCD1.2 reference assembly (https://www.ncbi.nlm.nih.gov/assembly/GCF_002263795.1).
Segregation of the BLG B alleles in the daughters of Sire 99
To investigate the segregation of the BLG B alleles, a new set of 576 milk samples was collected from the daughters of a single bull, known as Sire 99, that was identified in this study as a carrier of both the B and B’ alleles of the BLG gene. These cows were sampled during mid-lactation from approximately 220 commercial farms. The distribution of the concentration of the BLG B protein isoform in the milk samples of a subset of AB heterozygous daughters of Sire 99 (n = 234) was determined from mass spectrometry analysis. All genotypes were inferred from the mass spectrometry analysis and later confirmed by PCR (see below).
In vitro BLG-promoter assay
Using a luciferase reporter assay, the impact of the chr11:103256256G > A SNP (B’) on BLG expression was studied in vitro in two cell lines, the human mammary adenocarcinoma (MCF-7) and the Chinese Hamster Ovary (CHO-K1) that were obtained from the American Type Culture Collection, ATTC, Manassas, VA, USA. The 1819 bp genomic regions comprising 922 bp of the BLG promoter (relative to the transcription initiation site of transcript NM_173929.3), exon 1, intron 1, and the 5′ 139 bp of exon 2, were PCR-amplified from genomic DNA prepared from BB and B’B’ homozygous animals using the Expand Long Range dNTPack (Roche Diagnostics NZ Ltd, Auckland, New Zealand), with the forward primer 1 (5’- CTCGAGAGATCTCCACAGCCCGCTGGGTACTGATGCCC) and reverse primer 2 (5’- AAGCTTCAGCTGATTTCTGCAGCAGGATCTCCAGGTCGCC to amplify the B-allele) or reverse primer 3 (5’- AAGCTTGTCGACATTTCTGCAGCAGGATCTCCAGGTCGCC to amplify the B’-allele), respectively. All primers were designed using the Primer-BLAST web tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). To facilitate subcloning and diagnostic restriction analysis, recognition motifs for the XhoI and BglII restriction enzymes were added to the 5’-end of the forward primer 1, those for PvuII and HindIII to the reverse primer 2, and those for SalI and HindIII to the reverse primer 3, respectively (indicated in bold and underlined, respectively, in the above primer sequences). PCR products were cloned into pCR2.1-TOPO (Life Technologies New Zealand Ltd., Auckland, New Zealand). BLG allelic sequences were verified by Sanger sequencing, followed by subcloning of the XhoI/HindIII fragments into the promoter-less luciferase pGL4.16 vector (Promega Corp., Madison, WI) using the Rapid DNA Ligation kit (Roche) to create plasmids B and B’, which drove luciferase expression under the control of the proximal promoter and 5’ regions of the BLG B and B’ alleles, respectively.
MCF-7 and CHO-K1 cells were grown in MEM-alpha medium, supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 1 × penicillin/streptomycin (all Life Technologies). For the MCF-7 cells, the cell culture medium was supplemented with 10 μg/mL insulin (Sigma-Aldrich). Cells from both cell lines were grown to 80% confluence before transfection with the FuGene Transfection Reagent (Roche). Transfections were carried out using 6 µg plasmid DNA per 2 µL of the FuGene reagent. Transfection efficiency was normalised between wells by inclusion of the Renilla luciferase pGL4.73 vector (Promega) at a 9:1 ratio. Prior to harvest, cells were grown for a further 48 h in MEM-alpha medium, supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 1 × penicillin/streptomycin (all from Life Technologies), 10 μg/mL insulin, 5 μg/mL prolactin and 1 μg/mL hydrocortisone (all from Sigma-Aldrich). Cells were harvested by removing the medium and rinsed with phosphate-buffered saline (PBS) solution, and then lysed with Passive Lysis buffer (Promega).
The luciferase assay was performed using a Dual Luciferase Reporter Assay (Promega). Luminescence was measured using the EnVision Multilabel Plate Reader (PerkinElmer, Boston, MA). Cellular lysate (20 μL) was dispensed into a 96 well plate, 100 μL of LAR II (Promega) was added to each well and the luminescence measured five times. Subsequently, 100 μL of Stop & Glo Reagent (Promega) was added to each well and the luminescence was again measured five times. Measurements of cellular luciferase activity were averaged per well and normalised by the corresponding Renilla luciferase measurement giving a ratio of Luciferase: Renilla luciferase. Results, from 12 independent transfections for each plasmid, were averaged.
In vivo BLG expression
Tissue was sampled from the lactating mammary glands of 391 cows with known BLG genotypes by needle biopsy, as previously described [25], and total RNA was extracted. The animals were 3- and 4-year-old Holstein–Friesian \(\times\) Jersey cows (FJX) in mid-lactation. cDNA libraries were produced using the TruSeq RNA Sample Prep Kit v2 (Illumina) and were sequenced by the Australian Genome Research Facility (AGRF; Melbourne, Australia) on an Illumina HiSeq 2000 sequencer (see [26, 27] for details). To reduce mapping bias in downstream allele-specific expression (ASE) analyses, sequence reads were mapped to a masked version of the ARS-UCD1.2 Bos taurus genome, where known variants were replaced by bases that differed from both the reference and known alternative alleles. Mapping was performed using STAR (version 2.7.0) [28], following the multi-sample two-pass approach described in the STAR manual.
Genotyping
SNPs were called from the mapped RNA-seq reads using HaplotypeCaller from the GATK software package (version 4.1.8) [29, 30] following the application of the GATK tools markDuplicates and SplitNCigarReads [31]. Genotypes of each animal for the three BLG SNPs p.Glu64Asp (rs110066229), p.Val118Ala (rs109625649), and p.Leu26Leu (rs209645844) were used to determine the BLG genotype classes shown in Fig. 4.
RNA abundance measurement
To evaluate the effects of each genotype on BLG expression, total expression was determined using the Stringtie software [32] with the mapped RNA-seq reads and normalized for each animal through adjustment for total read count of that animal relative to the average read count for all animals. Subsequently, an ASE methodology was used to further examine the effect of each genotype on BLG expression. The “count” method from IGVtools [33] was used to determine the fractions of RNA-seq reads that contain each allele at positions Chr11:103,256,256 (rs209645844; to distinguish the B and B’ alleles) and Chr11:103,259,232 (rs109625649) to distinguish the A and B alleles. Reads from secondary alignments were excluded. The expression of the B’ allele relative to the A and B alleles was calculated as the ratio of reads containing the B’ allele in AB’ (n = 19) and BB’ (n = 14) genotyped animals relative to the equivalent B protein carrier classes (AB and BB).
Verification of the BLG chr11:103256256G > A SNP effect and its impact on milk composition
Approximately 700 cows that were daughters of B’ carrier sires and whose dams were also sired by B’ carrier sires were identified on commercial farms. Blood samples were collected from 510 of these cows across 350 commercial herds, and the DNA extracted for genotyping. The B’ SNP (rs209645844) and the SNPs defining the A, B (rs11066229 and rs109625649), and C (rs210096472) protein isoforms, were genotyped by the Australian Genome Research Facility (AGRF; Queensland, Australia). The AGRF custom SNP genotyping service used the single base extend method (SBE—Iplex GOLD chemistry), analysed on the Sequenom Compact Mass spectrometer.
Composite am/pm milk samples from the 510 genotyped cows were analysed by mid-infrared spectroscopy (FT120, Foss, Hillerod, Denmark) and their casein content was determined by acid precipitation [34]. Samples were taken at peak lactation, and those from cows with a somatic cell count greater than 400,000 in their milk and those without genotypes were excluded. BLG concentration was determined by mass spectrometry, as described above. Milk composition data from AA, BB and B’B’ BLG genotypes were analysed by ANOVA in JMP Version 8.0. (SAS Institute. Cary, NC, USA).
Results
Screening of BLG A and B isoform concentrations in milk samples
The LC/MS screen of milk samples from 10,641 individual cows enabled the quantification of BLG A or B protein isoforms. A plot of the concentration of the BLG B vs. A protein isoforms in the screened milk samples is in Fig. 1 and a cohort of almost 200 milk samples containing a relatively low concentration of the BLG B protein isoform was identified.
Identification of BLG A and B protein isoform populations, in milk samples collected from 10,641 cows during mid lactation. By plotting the B vs. A protein isoform concentrations of BLG (determined by mass spectrometry) milks containing AA, BB and AB protein isoforms can be distinguished. Black data points highlight the milk samples containing both protein isoforms but with a markedly lower concentration of the BLG B isoform
The cohort of cows that expressed the BLG B isoform at a low concentration was selected for further investigation. Heterozygous AB BLG cows (n = 180; Fig. 1) carrying the low-concentration B BLG allele were selected and sire frequency in this group was evaluated. These 180 cows were sired by 126 different sires, however, the five most frequently observed sires with a total of 25 daughters, were the sons or grandsons of the same sire. Among another group of 180 BB homozygous cows with the lowest milk BLG concentration, the five most frequently represented sires (out of 113 in the selection)) collectively had 42 daughters and all shared the same common ancestral sire as the AB heterozygous population of cows with a low concentration of BLG in milk. The top three sires were common to both the AB and BB groups.
One sire, which historically, was frequently used in New Zealand, (hereafter referred to as Sire 99), had 18 daughters in the low-concentration BLG B isoform BB group and seven daughters in the low-concentration BLG B isoform in the AB group and was a grandson of the common ancestor. Daughters of this sire were identified for further study with the objective of deciphering the mechanism responsible for the low-concentration BLG B isoform. Sire 99 was previously shown by genotyping to be homozygous for the B allele of BLG and was later confirmed to be heterozygous for the B’ allele. Hence, AB heterozygous daughters of Sire 99 could be used to investigate segregation of BLG B isoform concentration in milk.
Milk samples were collected from 576 daughters of Sire 99 in commercial herds and analysed by LC/MS to determine the concentrations of BLG A and B protein isoforms. The ratios of BLG B:A concentrations in milk from heterozygous AB daughters (n = 234) are shown in Fig. 2. Expressing the results as a B:A ratio allowed determination of the segregation of the BLG B isoform concentrations and revealed two distinct populations (Fig. 2), which indicated that this sire was heterozygous for an allele (or alleles) that regulates the BLG B protein isoform concentration. The mean concentration of the BLG B isoform in the segregating groups (n = 133 AB and n = 101 AB’) was equal to 54.0 ± 8.7 (SD) and 25.9 ± 6.1 arb. units, respectively.
Genome-wide association studies with total, and A and B isoform concentrations of milk BLG
In the GWAS of total BLG concentration, 22,888 SNPs were significantly associated, which were all located on BTA11 in the region ranging from 82.4 to 106.9 Mb. Two SNPs which defined the two amino acid polymorphisms associated with the A or B protein isoforms ranked 83 and 102 (based on –log10(p-values)) among all significant SNPs (see Additional file 2: Table S1). Among the genotyped animals, the AB heterozygotes (n = 2091) were selected, and the GWAS was repeated using the concentration of either the BLG A or B protein isoforms, determined by mass spectrometry. In total, 1450 SNPs were significantly associated with BLG B isoform concentrations, of which 1449 were on BTA11 (the top 250 SNPs are shown in Additional file 2: Table S2). The 1330 SNPs that were most significantly associated with BLG B isoform concentration were located on BTA11 in the region between 87.7 and 107.0 Mb, with –log10(p-values) ranging from 1.91e−58 to 4.47e−11. Among these, a synonymous SNP, p.Leu26Leu (rs209645844) was located at position + 78 relative to the start site of the BLG gene. This SNP had a minor allele frequency of 1.87% in the dataset of AB heterozygous cows and ranked 2472 for significance (−log10(p-values)) among all SNPs in the GWAS across all animals for total BLG. Most importantly, Sire 99 was heterozygous for this SNP. Five other SNPs had a similar level of significance and were all located downstream of this synonymous SNP. Two of these were in introns and three were outside the UTR region of the BLG gene (see Additional file 2: Table S2). Although one significant association with BLG B isoform concentration was observed on chromosome BTA3 (position 67,051,732), evidence for any additional QTL was weak, due to a lack of support from adjacent SNPs that were in LD. One hundred and forty-one SNPs were significantly associated with variation in BLG A isoform concentration and were all located on BTA11.
Functional consequence of the BLG B’ allele in vitro
Given that, among the top candidate genetic variants for a low-concentration BLG, a synonymous mutation (p.Leu26Leu) was found, it was of interest to investigate whether this mutation might mediate an impact on BLG expression through modification of mRNA stability, splicing, or some other molecular mechanism. To test this hypothesis, we undertook reporter assays in two mammalian cell lines. Luciferase reporter activity was reduced to about 60% in cells containing the luciferase plasmid under control of the promotor and 5’ region of the BLG B’ allele, compared to the plasmid expressing luciferase under the control of the analogous region from the BLG B allele in both MCF-7 and CHO-K1 cell lines (Fig. 3).
In vitro gene expression of a BLG-luciferase reporter construct in MCF-7 a and CHO-K1 b cells. Constructs with the wild type G allele of rs209645844 (B allele) and an analogous construct containing the chr11: 103256256G > AA allele (B’ allele) are shown. The genomic regions used in the reporter constructs included 881 bp of the BLG promoter (relative to the transcription initiation site of transcript NM_173929.3), exon 1, intron 1, and 139 bp of exon 2. Results are means from 12 separate transfections undertaken for each construct. Bars are standard errors of the mean
In vivo expression of BLG
The expression of BLG mRNA in mammary biopsies from cows of different BLG genotypes is shown in Fig. 4. The majority of the RNA-seq animals were genotyped as AB, and no B’B’ animals were detected in the sampled population. BLG mRNA levels observed in the AA animals were 1.45 (SD = 0.044 by bootstrapping) times greater than those in the BB animals, and the BLG mRNA levels in the BB animals were 1.55 (SD = 0.071) times greater than those in the BB’ animals.
Gene expression of BLG in mammary tissue obtained from biopsies of cows (n = 392) in mid-lactation. Normalized read counts from RNA-Seq of mammary biopsies are shown for each BLG genotype class (n = 98, 191, 19, 70 and 14 for AA, AB, AB’, BB and BB’ classes, respectively). There were no B’B’ homozygous individuals in the dataset
The read counts of each genotype of the heterozygous animals were used to determine allele-specific effects of each allele on BLG mRNA levels. The mean expression of the B allele was 64.2 ± 1.2% of that of the A allele when comparing milk samples from homozygous AA and BB cows, and the mean of expression of the B’ allele was 38.2% of that of the B allele when comparing milk samples from 19 heterozygous AB’ and 190 heterozygous AB cows. Expression of the B’ allele was equal to 41.9 ± 1.0% of that of the B allele in 14 heterozygous BB’ cows.
Effects of BLG genotype on milk composition
Among the 510 cows used for genotyping and assessing milk composition, 28 were homozygous for the B’, 64 homozygous for the B, and 29 homozygous for the A allele of BLG. Milk samples from seven cows that carried the C allele of BLG were excluded. Milk composition was very similar between the groups with a small but significant (P < 0.05) increase in casein number (casein calculated as a percentage of true protein; Table 1) in milk from the homozygous B’ cows. Differences between the major milk components (fat, crude protein, true protein, and lactose) by genotype, were not statistically significant.
Absolute concentrations of BLG were also determined by HPLC in milk samples collected at mid-lactation from three cows that were homozygous for the B’ allele. The mean BLG concentration was 1.38 ± 0.24 (SEM) g/L. In a group of 16 contemporary cows in the same commercial herd, matched for age, the mean BLG concentration in milk was 4.84 ± 0.29 g/L.
Discussion
Our results demonstrate the utility of a high-throughput screening method for milk BLG, which led to the discovery and characterization of a relatively rare, genetic variant with a significant impact on milk protein composition. A synonymous SNP, in exon 1 of the BLG gene, was identified by this screening method and was determined to be responsible for a low concentration of the BLG B protein isoform in milk. We refer to this BLG genetic variant that includes the A allele of this SNP, as B’. This variant is linked to a sire family that has been widely used in the New Zealand dairy industry. Evidence that the A allele at this SNP is the causative variant includes the association of the B’ variant with a low concentration of the BLG B protein in milk, reduced expression of a BLG-luciferase reporter in a cell culture system, and reduced BLG mRNA levels in lactating mammary tissue. Furthermore, this SNP is among the five most significant SNPs identified in a GWAS of BLG B protein concentration in milk.
Among the possible mechanisms by which the B’ allele might reduce BLG gene expression are the disruption of an exonic splice enhancer, the modification of mRNA stability or the disruption of a regulatory promoter element overlapping with BLG exon 1. Previous work by [35] described positive and negative, intragenic, regulatory elements in the ovine BLG gene in transient transfection experiments in cell lines and in transgenic mice. In particular, removal of sequences within exon 1, intron 1 and exon 2 of BLG abolished BLG–directed expression of human serum albumin in vitro, although not in vivo. Promoter elements are typically found immediately upstream of the transcription start site, but they have also been observed within the first exon of at least one gene [36, 37]. We examined the BLG exon 1 for the presence of transcription factor binding sites, using the R packages JASPAR2018 [38] and TFBSTools [39], but we did not identify any binding sites that were affected by the B’ allele, thus there is no evidence that this allele reduces BLG expression by compromising promoter elements within the first exon.
Another mechanism that might explain the effect of the B’ allele is a reduction of the rate of intron excision, which thus decreases the rate of production of mature BLG mRNA. To investigate this, we analysed the 3′ 40 bp of exon 1, using the software package RESCUE-ESE [40, 41] and both the human and mouse exonic splice enhancer (ESE) hexamer sets. No effect was observed for the B’ allele when using the human hexamers. However, it is interesting to note that the B’ allele removed three ESE elements that were detected using the mouse hexamer set (seven other elements were common to the B and B’ alleles). Nevertheless, no aberrant splicing events were detected when we examined the RNA-seq alignments generated from animals carrying the B’ allele, so it is unlikely that this synonymous SNP acts via a splicing-mediated mechanism.
Several studies have focussed on the association between SNPs and milk BLG concentration, based on the observation that the BLG A isoform was associated with ~ 50% more BLG protein in milk than the B isoform [10, 42]. At least two different haplotypes within the A and B BLG alleles were associated with variation in BLG concentration suggesting that the BLG chromosomal region contains further mutations affecting both A and B protein isoform concentrations [8]. Furthermore, ten polymorphic sites in the 3′ 733 bp of the promoter region of BLG were identified that were specific either to the A or the B BLG alleles and associated with differential expression of BLG [43]. In another study, polymorphisms located within an AP2 binding site of the promoter region of BLG were implicated in allele-specific differences in BLG gene expression [44].
Braunschweig and Leeb [16] identified a novel SNP associated with a low-concentration variant of BLG in milk from Swiss Brown cattle, which corresponded to a unique, C to A transversion, 215 bp upstream from the translation start site, although causation was not proven. This variant has not been observed in the genotyped or sequenced New Zealand dairy population.
The B’ allele of the BLG gene has already been reported in a comparison of BLG sequences from 19 cow breeds [45]. It was present at a frequency of 2–3.5% in Angus, Dexter, SDM (black and white Danish dairy) and Jersey cattle and of 11% in Hereford cattle. The best estimates of B’ allele frequency in New Zealand dairy cattle are based on a genotyped population of 160,000 animals and indicate a 1–2% allele frequency in Friesian and Friesian X Jersey breeds. Direct genotyping of the chr11:103256256G > A polymorphism in DNA extracted from semen stocks for 1378 highly-used sires in New Zealand, identified 49 sires that carry the B’ allele. Based on pedigree data, all these sires could be linked back to a foundation sire in New Zealand that began commercial use in the 1990’s.
The B allele of BLG is associated with a lower BLG concentration [10, 46], a greater casein number [10, 44], a somewhat longer renneting time and lower heat stability [47] of milk. Boland and Hill [11] showed that the preferential selection of animals carrying the B allele of BLG, resulted in increased milk casein and cheese yield per kg of milk protein compared to animals carrying the A allele. Thus, selection for the BLG B allele will result in a greater casein number and increased cheese yield, and selection for the BLG B’ allele is expected to improve casein number and cheese yield still further, compared to milks containing the A and B protein isoforms.
The BLG B protein isoform has several other advantages in terms of milk processing characteristics which the B’ allele may improve further. Under the effect of heat, a reactive sulphydryl group within the BLG protein is exposed, which enables cross-linking of BLG with other proteins, particularly κ-casein. A reduction in BLG concentration in milk may facilitate a further reduction in plant fouling rates [13].
BLG is a major allergen in milk [48, 49] but it is unlikely that the allergenicity of milk produced by cows carrying the B’ allele would be altered by the resulting reduction in BLG concentration. To improve the allergenic properties of cows’ milk, it would be necessary to eliminate BLG from milk through gene editing [50] or to detect a “natural null” allele using similar screening methods. However, as BLG is critical for gel formation in some milk products [51], reducing the expression of BLG may have some potentially negative consequences for milk processing, which will require more detailed investigation.
Conclusions
A targeted, high-throughput screen of milk samples from cows in commercial herds has enabled the identification of a synonymous SNP, in exon 1 of the BLG gene, encoding the BLG B protein isoform. This SNP was associated with a substantial reduction in the expression of the BLG gene and an approximately 70% lower BLG concentration in the milk of homozygous carriers. Milk from cows that carry the B’ BLG allele have a greater casein number and may have improved processing characteristics. This SNP has not been detected in the BLG allele coding for the A protein isoform. The causal SNP was identified in a sire family that has been used in dairy cattle breeding in New Zealand for the past 30 years. Currently, the estimated frequency of this B’ BLG allele in the Friesian and Friesian \(\times\) Jersey dairy population is 1–2%. The precise mechanism through which this SNP down-regulates BLG expression and decreases BLG secretion into milk remains to be determined.
Availability of data and materials
GWAS data have been uploaded, in part, as additional tables. Further genome-wide data and ancillary information are available upon reasonable request following execution of a data transfer agreement, and with permission of Livestock Improvement Corporation.
References
Vegarud GE, Langsrud T, Svenning C. Mineral-binding milk proteins and peptides; occurrence, biochemical and technological characteristics. Br J Nutr. 2000;84:S91–8.
Flower DR. The lipocalin protein family: structure and function. Biochem J. 1996;318:1–14.
Altmäe S, Koel M, Võsa U, Adler P, Suhorutšenko M, Laisk-Podar T, et al. Meta-signature of human endometrial receptivity: a meta-analysis and validation study of transcriptomic biomarkers. Sci Rep. 2017;7:10077.
Yang MC, Chen NC, Chen CJ, Wu CY, Mao SJ. Evidence for beta-lactoglobulin involvement in vitamin D transport in vivo—role of the gamma-turn (Leu-Pro-Met) of beta-lactoglobulin in vitamin D binding. FEBS J. 2009;276:2251–65.
Le Maux S, Bouhallab S, Giblin L, Brodkorb A, Croguennec T. Bovine β-lactoglobulin/fatty acid complexes: binding, structural, and biological properties. Dairy Sci Technol. 2014;94:409–26.
Caroli AM, Chessa S, Erhardt GJ. Invited review: milk protein polymorphisms in cattle: effect on animal breeding and human nutrition. J Dairy Sci. 2009;92:5335–52.
Ganai NA, Bovenhuis H, van Arendonk JA, Visker MH. Novel polymorphisms in the bovine β-lactoglobulin gene and their effects on β-lactoglobulin protein concentration in milk. Anim Genet. 2009;40:127–33.
Bedere N, Bovenhuis H. Characterizing a region on BTA11 affecting β-lactoglobulin content of milk using high-density genotyping and haplotype grouping. BMC Genet. 2017;18:17.
Wilkins RJ, Davey HW, Wheeler TT, Ford CA. Differential expression of β-lactoglobulin alleles A and B in dairy cattle. In: Wilde CJ, Peaker M, Knight CH, editors. Intracellular signaling in the mammary gland. New York: Plenum Press; 1995. p. 189–90.
Lundén A, Nilsson M, Janson L. Marked effect of β-lactoglobulin polymorphism on the ratio of casein to total protein in milk. J Dairy Sci. 1997;80:2996–3005.
Boland MJ, Hill JP. Genetic selection to increase cheese yield - The Kaikoura experience. Aust J Dairy Technol. 2001;56:171–6.
Meza-Nieto MA, González-Córdova AF, Piloni-Martini J, Vallejo-Cordoba B. Effect of β-lactoglobulin A and B whey protein variants on cheese yield potential of a model milk system. J Dairy Sci. 2013;96:6777–81.
Hill JP, Thresher WC, Boland MJ, Creamer LK, Anema SG, Manderson G, et al. The polymorphism of the milk protein β-lactoglobulin. A review. In: Welch RAS, Burns DJW, Davis SR, Popay AI, Prosser CG, editors., et al., Milk composition, production and biotechnology. New York: CAB International; 1997. p. 173–202.
Schopen GC, Visker MH, Koks PD, Mullaart E, van Arendonk JA, Bovenhuis H. Whole-genome association study for milk protein composition in dairy cattle. J Dairy Sci. 2011;94:3148–58.
Gambra R, Peñagaricano F, Kropp J, Khateeb K, Weigel KA, Lucey J, et al. Genomic architecture of bovine κ-casein and β-lactoglobulin. J Dairy Sci. 2013;96:5333–43.
Braunschweig MH, Leeb T. Aberrant low expression level of bovine β-lactoglobulin is associated with a C to A transversion in the BLG promoter region. J Dairy Sci. 2006;89:4414–9.
Berry SD, Lopez-Villalobos N, Beattie EM, Davis SR, Adams LF, Thomas NL, et al. Mapping a quantitative trait locus for the concentration of beta-lactoglobulin in milk, and the effect of beta-lactoglobulin genetic variants on the composition of milk from Holstein-Friesian x Jersey crossbred cows. N Z Vet J. 2010;58:1–5.
Day L, Williams RP, Otter D, Augustin MA. Casein polymorphism heterogeneity influences casein micelle size in milk of individual cows. J Dairy Sci. 2015;98:3633–44.
Sambrook J, Russell DW. Purification of nucleic acids by extraction with phenol:chloroform. Cold Spring Harb Protoc. 2006. https://doi.org/10.1101/pdb.prot4455.
Littlejohn MD, Tiplady K, Fink TA, Lehnert K, Lopdell T, Johnson T, et al. Sequence-based association analysis reveals an MGST1 eQTL with pleiotropic effects on bovine milk composition. Sci Rep. 2016;6:25376.
Lopdell TJ, Tiplady K, Struchalin M, Johnson TJ, Keehan M, Sherlock R, et al. DNA and RNA-sequence based GWAS highlights membrane-transport genes as key modulators of milk lactose content. BMC Genomics. 2017;18:968.
Jivanji S, Worth G, Lopdell TJ, Yeates A, Couldrey C, Reynolds E, et al. Genome-wide association analysis reveals QTL and candidate mutations involved in white spotting in cattle. Genet Sel Evol. 2019;51:62.
Pinheiro J, Bates D. DebRoy S, Sarkar D and R Core Team 2018_nlme: Linear and Nonlinear Mixed Effects Models_R package version 3.1–137. https://CRAN.R-project.org/package=nlme. Accessed 15 Feb 2022
Yang J, Lee SH, Goddard ME, Visscher PM. GCTA: a tool for genome-wide complex trait analysis. Am J Hum Genet. 2011;88:76–82.
Littlejohn MD, Walker CG, Ward HE, Lehnert KB, Snell RG, Verkerk GA, et al. Effects of reduced frequency of milk removal on gene expression in the bovine mammary gland. Physiol Genomics. 2010;41:21–32.
Littlejohn MD, Tiplady K, Lopdell T, Law TA, Scott A, Harland C, et al. Expression variants of the lipogenic AGPAT6 gene affect diverse milk composition phenotypes in Bos taurus. PLoS One. 2014;9:e85757.
Lopdell TJ, Tiplady K, Couldrey C, Johnson TJ, Keehan M, Davis SR, et al. Multiple QTL underlie milk phenotypes at the CSF2RB locus. Genet Sel Evol. 2019;51:3.
Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15–21.
Poplin R, Ruano-Rubio V, DePristo MA, Fennell TJ, Carneiro MO, Van der Auwera GA, et al. Scaling accurate genetic variant discovery to tens of thousands of samples. BioRxiv. 2017;10:201178.
McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010;20:1297–303.
DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011;43:491–8.
Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33:290–5.
Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, et al. Integrative genomics viewer. Nat Biotechnol. 2011;29:24–6.
Auldist MJ, Walsh BJ, Thomson NA. Seasonal and lactational influences on bovine milk composition in New Zealand. J Dairy Res. 1998;65:401–11.
Barash I, Nathan M, Kari R, Ilan N, Shani M, Hurwitz DR. Elements within the β-lactoglobulin gene inhibit expression of human serum albumin cDNA and minigenes in transfected cells but rescue their expression in the mammary gland of transgenic mice. Nucleic Acids Res. 1996;24:602–10.
Harbo HF, Celius EG, Vartdal F, Spurkland A. CTLA4 promoter and exon 1 dimorphisms in multiple sclerosis. Tissue Antigens. 1999;53:106–10.
Ligers A, Teleshova N, Masterman T, Huang WX, Hillert J. CTLA-4 gene expression is influenced by promoter and exon 1 polymorphisms. Genes Immun. 2001;2:145–52.
Khan A, Fornes O, Stigliani A, Gheorghe M, Castro-Mondragon JA, van der Lee R, et al. JASPAR 2018: update of the open-access database of transcription factor binding profiles and its web framework. Nucleic Acids Res. 2018;46:D260–6.
Tan G, Lenhard B. TFBSTools: an R/bioconductor package for transcription factor binding site analysis. Bioinformatics. 2016;32:1555–6.
Fairbrother WG, Yeh RF, Sharp PA, Burge CB. Predictive identification of exonic splicing enhancers in human genes. Science. 2002;297:1007–13.
Yeo G, Hoon S, Venkatesh B, Burge CB. Variation in sequence and organization of splicing regulatory elements in vertebrate genes. Proc Natl Acad Sci USA. 2004;101:15700–5.
Graml R, Weiss G, Buchberger J, Pirchner F. Different rates of synthesis of whey protein and casein by alleles of the β-lactoglobulin and α s1-casein locus in cattle. Genet Sel Evol. 1989;21:547–54.
Folch JM, Dovč P, Medrano JF. Differential expression of bovine β-lactoglobulin A and B promoter variants in transiently transfected HC11 cells. J Dairy Res. 1999;66:537–44.
Kuss AW, Gogol J, Geldermann H. Associations of a polymorphic AP-2 binding site in the 5′-flanking region of the bovine β-lactoglobulin gene with milk proteins. J Dairy Sci. 2003;86:2213–8.
Bertelsen HP, Andersen PK, Nielsen RO, Panitz F, Bendixen C. Identifying rare genetic variants of milk genes. In: Proceedings of the Fifth EADGene Annual Conference on Animal Genomics Research: 13–15 October 2009; Paris. 2009. https://pure.au.dk/ws/files/2635343/Poster Accessed 15 Feb 2022.
Ng-Kwai-Hang KF, Monardes HG, Hayes JF. Association between genetic polymorphism of milk proteins and production traits during three lactations. J Dairy Sci. 1990;73:3414–20.
Berg G, Escher JM, De Koning PJ, Bovenhuis H. Genetic polymorphism of κ-casein and β-lactoglobulin in relation to milk composition and processing properties. Netherlands Milk Dairy J. 1992;46:145–68.
Chatel JM, Bernard H, Clement G, Frobert Y, Batt CA, Gavalchin J, et al. Expression, purification and immunochemical characterization of recombinant bovine beta-lactoglobulin, a major cow milk allergen. Mol Immunol. 1996;33:1113–8.
Tsabouri S, Douros K, Priftis KN. Cow’s milk allergenicity. Endocr Metab Immune Disord Drug Targets. 2014;14:16–26.
Wei J, Wagner S, Maclean P, Brophy B, Cole S, Smolenski G, et al. Cattle with a precise, zygote-mediated deletion safely eliminate the major milk allergen beta-lactoglobulin. Sci Rep. 2018;8:7661.
McSwiney M, Singh H, Campanella O, Creamer LK. Thermal gelation and denaturation of bovine β-lactoglobulins A and B. J Dairy Res. 1994;61:221–32.
Acknowledgements
Thanks are due to the Herd Test staff at LIC in providing the milk samples for this project. The help of Kerst Stelwagen with drafting of the manuscript, Brian Treloar and Don Otter for HPLC analyses and Susannah Leydon-Davis for preparing the figures, is gratefully acknowledged.
Funding
Funding for the study was provided through BoviQuest, a joint venture between Livestock Improvement Corporation and ViaLactia Biosciences Ltd, a subsidiary (now closed) of Fonterra Cooperative Ltd., Auckland, New Zealand. This work was funded in part by a grant from the Foundation for Research, Science and Technology (NZ) to ViaLactia Biosciences.
Author information
Authors and Affiliations
Contributions
VK and DP developed and ran the LC/MS screening method for β-lactoglobulin. KT and TL performed the GWAS analyses. HW, AB and NT and KL performed the cloning and cell cultures. SD, SB, LA, KC and A-AU managed and performed all tissue, milk and blood sampling. RS supervised the animal studies and KL supervised the laboratory studies. ML and TL carried out the RNAseq analysis. SD, ML, TL and KT prepared the manuscript. All authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
All animal experiments were conducted in accordance with the rules and guidelines outlined in the New Zealand Animal Welfare Act (1999). Most data were generated as part of routine commercial activities outside the scope of that requiring formal committee assessment and ethical approval (as defined by the above guidelines). For the mammary tissue biopsy experiment, samples were obtained in accordance with protocols approved by the Ruakura Animal Ethics Committee, Hamilton, New Zealand. No animals were sacrificed for this study (approval AEC 12845).
Consent for publication
Consent was received from Livestock Improvement Corporation Ltd, Hamilton, New Zealand and Fonterra Co-operative Ltd., Auckland, New Zealand.
Competing interests
The authors declare that they have no competing interests.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1:
Figure S1. Correlation between the concentrations of BLG A and B protein isoforms obtained by the mass spectrometry (MS) screening method with those obtained by a high-performance liquid chromatography (HPLC) method [18]. Cows (n = 40) were a mix of heterozygous AB and homozygous AA and BB individuals.
Additional file 2:
Table S1. GWAS results for the top 250 SNPs in the region of the BLG gene that were associated with total BLG concentration in milk (n = 4140). Two SNPs that differentiate the A and B protein isoforms are highlighted. Table S2. GWAS results for the top 250 SNPs in the region of the BLG gene that were associated with BLG B isoform concentrations in milks from heterozygous AB animals (n = 1966). The top SNP (highlighted) is B’ (chr11: 103256256G > A).
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Davis, S.R., Ward, H.E., Kelly, V. et al. Screening for phenotypic outliers identifies an unusually low concentration of a β-lactoglobulin B protein isoform in bovine milk caused by a synonymous SNP. Genet Sel Evol 54, 22 (2022). https://doi.org/10.1186/s12711-022-00711-z
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s12711-022-00711-z